gen-script q-pcr (taqman) online primer design tool Search Results


90
GenScript corporation gp qpcr primer f:cattcacctggactttgtcagactc
Gp Qpcr Primer F:Cattcacctggactttgtcagactc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gp qpcr primer f:cattcacctggactttgtcagactc/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gp qpcr primer f:cattcacctggactttgtcagactc - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation primers for rt-qpcr
Primers For Rt Qpcr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers for rt-qpcr/product/GenScript corporation
Average 90 stars, based on 1 article reviews
primers for rt-qpcr - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation rt-qpcr (taqman) primer designing software
Rt Qpcr (Taqman) Primer Designing Software, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt-qpcr (taqman) primer designing software/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rt-qpcr (taqman) primer designing software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation real-time pcr software
Real Time Pcr Software, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/real-time pcr software/product/GenScript corporation
Average 90 stars, based on 1 article reviews
real-time pcr software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Ribobio co bulge-looptm mirna rt-qpcr primer kits
Bulge Looptm Mirna Rt Qpcr Primer Kits, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bulge-looptm mirna rt-qpcr primer kits/product/Ribobio co
Average 90 stars, based on 1 article reviews
bulge-looptm mirna rt-qpcr primer kits - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation rt–qpcr primers 18 ghugts
Rt–Qpcr Primers 18 Ghugts, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rt–qpcr primers 18 ghugts/product/GenScript corporation
Average 90 stars, based on 1 article reviews
rt–qpcr primers 18 ghugts - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation primers for quantitative real time pcr (qpcr)
Primers For Quantitative Real Time Pcr (Qpcr), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers for quantitative real time pcr (qpcr)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
primers for quantitative real time pcr (qpcr) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Microsynth ag oligonucleotides qpcr primers
Oligonucleotides Qpcr Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotides qpcr primers/product/Microsynth ag
Average 90 stars, based on 1 article reviews
oligonucleotides qpcr primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation gen script online tool
Gen Script Online Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gen script online tool/product/GenScript corporation
Average 90 stars, based on 1 article reviews
gen script online tool - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc gen script-real time pcr primer design tool
Gen Script Real Time Pcr Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gen script-real time pcr primer design tool/product/PrimerDesign Inc
Average 90 stars, based on 1 article reviews
gen script-real time pcr primer design tool - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation oligonucleotides and primers
Oligonucleotides And Primers, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotides and primers/product/GenScript corporation
Average 90 stars, based on 1 article reviews
oligonucleotides and primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sangon Biotech q-pcr primers
Q Pcr Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/q-pcr primers/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
q-pcr primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results