90
|
GenScript corporation
gp qpcr primer f:cattcacctggactttgtcagactc Gp Qpcr Primer F:Cattcacctggactttgtcagactc, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gp qpcr primer f:cattcacctggactttgtcagactc/product/GenScript corporation Average 90 stars, based on 1 article reviews
gp qpcr primer f:cattcacctggactttgtcagactc - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
primers for rt-qpcr Primers For Rt Qpcr, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for rt-qpcr/product/GenScript corporation Average 90 stars, based on 1 article reviews
primers for rt-qpcr - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
rt-qpcr (taqman) primer designing software Rt Qpcr (Taqman) Primer Designing Software, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt-qpcr (taqman) primer designing software/product/GenScript corporation Average 90 stars, based on 1 article reviews
rt-qpcr (taqman) primer designing software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
real-time pcr software Real Time Pcr Software, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/real-time pcr software/product/GenScript corporation Average 90 stars, based on 1 article reviews
real-time pcr software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Ribobio co
bulge-looptm mirna rt-qpcr primer kits Bulge Looptm Mirna Rt Qpcr Primer Kits, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bulge-looptm mirna rt-qpcr primer kits/product/Ribobio co Average 90 stars, based on 1 article reviews
bulge-looptm mirna rt-qpcr primer kits - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
rt–qpcr primers 18 ghugts Rt–Qpcr Primers 18 Ghugts, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rt–qpcr primers 18 ghugts/product/GenScript corporation Average 90 stars, based on 1 article reviews
rt–qpcr primers 18 ghugts - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
primers for quantitative real time pcr (qpcr) Primers For Quantitative Real Time Pcr (Qpcr), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers for quantitative real time pcr (qpcr)/product/GenScript corporation Average 90 stars, based on 1 article reviews
primers for quantitative real time pcr (qpcr) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Microsynth ag
oligonucleotides qpcr primers Oligonucleotides Qpcr Primers, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligonucleotides qpcr primers/product/Microsynth ag Average 90 stars, based on 1 article reviews
oligonucleotides qpcr primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
gen script online tool Gen Script Online Tool, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gen script online tool/product/GenScript corporation Average 90 stars, based on 1 article reviews
gen script online tool - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
gen script-real time pcr primer design tool Gen Script Real Time Pcr Primer Design Tool, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gen script-real time pcr primer design tool/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
gen script-real time pcr primer design tool - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
oligonucleotides and primers Oligonucleotides And Primers, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligonucleotides and primers/product/GenScript corporation Average 90 stars, based on 1 article reviews
oligonucleotides and primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Sangon Biotech
q-pcr primers Q Pcr Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/q-pcr primers/product/Sangon Biotech Average 90 stars, based on 1 article reviews
q-pcr primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |